| Products/Services Used | Details | Operation |
|---|---|---|
| Proteins, Expression, Isolation and Analysis> | The eStain L1 (L00657C, Genscript, Nanjing, China) was used to stain the protein gels. The single-stranded DNA template (200bp, AGGTCGCCAGTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATACCGATTCCGCAGTATTGCACTCTATCGTCGCCAGCCC) and a primer (CTGGCGACCTGGGCTGGCGAC) were synthesized by Genscript Biotechnology (Nanjing, China). The coding sequences of Phi29 polymerase, wild-type SRHS and BBum polymerases, and other mutant variants were codon-optimized for E. coli expression, synthesized and cloned into the Pet30a plasmids by Genscript Biotechnology (Nanjing, China). | Get A Quote |
| Single-Stranded DNA Synthesis> | Get A Quote |
Polymerase-coupled nanopore sequencing requires DNA polymerases with strong strand displacement activity and high processivity to sustain continuous signal generation. In this study, we characterized two novel B family DNA polymerases, SRHS and BBum, isolated from Bacillus phages SRT01hs and BeachBum, respectively. Both enzymes exhibited robust strand displacement, 3'→5' exonuclease activity, and maintained processivity under diverse reaction conditions, including across a broad temperature range (10-45 °C) and in the presence of multiple divalent metal cofactors (Mg2+, Mn2+, Fe2+), comparable to the well-characterized Phi29 polymerase. Through biochemical analysis of mutants designed using AlphaFold3-predic... More