| Products/Services Used | Details | Operation |
|---|---|---|
| GenParts™ DNA Fragments> | A DNA fragment corresponding to the B. anthracis BAS3568 (ctaM) gene preceded by 35 bp (AAGCTTAGCCAGTACAAATTAGGAGAGGTCACCAA) corresponding to the ribosome-binding site region of B. subtilis ctaM and a HindIII site was de novo synthesized by Genscript | Get A Quote |
Cytochrome c oxidase in the respiratory chain of bacteria and mitochondria couples the reduction of molecular oxygen to form water with the generation of a transmembrane proton gradient. Bacillus subtilis has two heme A-containing heme-copper oxidases: the menaquinol oxidase cytochrome aa and the cytochrome c oxidase cytochrome caa . By screening three collections of mutants for defective cytochrome c oxidase, we found the genes for two, new membrane-bound assembly factors in B. subtilis: ytkA and yozB (renamed ctaK and ctaM, respectively). CtaK is a lipoprotein without sequence similarity to any protein of known function. We show that CtaK functions together with Sco1 (YpmQ) in a pathway, leading to the assemb... More